Order Kazusa clone(s) from : ![]() |
Product ID | ORK00362 |
---|---|
Accession No | D26488 |
Description | WD repeat domain 43 |
Clone name | ha02056 |
Vector information | |
cDNA sequence | DNA sequence (3500 bp) Predicted protein sequence (686 aa) |
HaloTag ORF Clone |
FHC00362
![]() |
Flexi ORF Clone | FXC00362 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0007
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1437 bp |
---|---|
Genome contig ID | gi89161199f_28871040 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (153550 - 153599) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 28971040 | 29024588 | 18 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001680 | 28 | 51 | PF00400 | WD40 repeat |
IPR001680 | 125 | 163 | PF00400 | WD40 repeat | |
IPR001680 | 167 | 203 | PF00400 | WD40 repeat | |
IPR012979 | 499 | 585 | PF08162 | Protein of unknown function NUC189 | |
HMMSmart | IPR001680 | 15 | 51 | SM00320 | WD40 repeat |
IPR001680 | 54 | 119 | SM00320 | WD40 repeat | |
IPR001680 | 122 | 163 | SM00320 | WD40 repeat | |
IPR001680 | 166 | 203 | SM00320 | WD40 repeat | |
IPR001680 | 206 | 259 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 131 | 166 | PS50082 | WD40 repeat |
IPR001680 | 131 | 268 | PS50294 | WD40 repeat |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 102 | QTDLLALGTAVGSILLYSTVKGE | 124 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | GAGCCGATATTGGCTTAGTG |
Primer_r | GGTTCAAACTTGCTTTCCCA |
PCR product length | 240 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |