Order Kazusa clone(s) from : ![]() |
Product ID | ORK01950 |
---|---|
Accession No | D13636 |
Description | general transcription factor IIIC, polypeptide 2, beta 110kDa, transcript variant 1 |
Clone name | ha00409 |
Vector information | |
cDNA sequence | DNA sequence (3594 bp) Predicted protein sequence (924 aa) |
HaloTag ORF Clone |
FHC01950
![]() |
Flexi ORF Clone | FXC01950 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0011
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 819 bp |
---|---|
Genome contig ID | gi89161199r_27302227 |
PolyA signal sequence (ATTAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 27402227 | 27433124 | 19 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001680 | 616 | 655 | PF00400 | WD40 repeat |
HMMSmart | IPR001680 | 469 | 525 | SM00320 | WD40 repeat |
IPR001680 | 547 | 597 | SM00320 | WD40 repeat | |
IPR001680 | 615 | 655 | SM00320 | WD40 repeat | |
IPR001680 | 838 | 878 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 622 | 657 | PS50082 | WD40 repeat |
IPR001680 | 622 | 664 | PS50294 | WD40 repeat | |
ScanRegExp | IPR001680 | 584 | 598 | PS00678 | WD40 repeat |
IPR001680 | 642 | 656 | PS00678 | WD40 repeat |
Panel name | Genebridge 4 |
---|---|
Primer_f | TTGGGGGGTGCTGATGGATAC |
Primer_r | CTGATTTAGCACCTCTTGTCC |
PCR product length | 112 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |