Order Kazusa clone(s) from : ![]() |
Product ID | ORK00363 |
---|---|
Accession No | D25216 |
Description | leucine rich repeat containing 14, transcript variant 2 |
Clone name | ha00442 |
Vector information | |
cDNA sequence | DNA sequence (5323 bp) Predicted protein sequence (513 aa) |
HaloTag ORF Clone |
FHC00363
![]() |
Flexi ORF Clone | FXC00363 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0014
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3695 bp |
---|---|
Genome contig ID | gi51511724f_145615806 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (105561 - 105610) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 145714199 | 145721365 | 4 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | CAGCAGCAGCGGCAGCAGTT |
Primer_r | CATCTATTGGCTGGCTCTCG |
PCR product length | 152 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |