Gene/Protein Characteristic Table for KIAA0017
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00365
Accession No D87686
Description splicing factor 3b, subunit 3, 130kDa
Clone name ha02425
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (4294 bp)
Predicted protein sequence (1253 aa)
Flexi ORF Clone FXC00365
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0017 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4294 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 484 bp
Genome contig ID gi51511732f_69015247
PolyA signal sequence
(AATAGA,-24)
+----*----+----*----+----*----+----
ATCTAACCAGAAATAGAAACCTAGTTTTTAAGGTG
Flanking genome sequence
(148456 - 148505)
----+----*----+----*----+----*----+----*----+----*
ACTGGCATCCATGTGTCTTGTTCTGGAGATGAGGATGTAGGTGGGAGGTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 f 69115247 69163701 26 99.9 Perfect prediction
Features of the protein sequence
Description

Length: 1253 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q15393 0 100.0 Splicing factor...
Homo sapiens
XP_536791 0 99.9 similar to spli...
Canis lupus fam...
BAF84457 0 99.9 unnamed protein...
Homo sapiens
Q921M3 0 99.9 Splicing factor...
Mus musculus
AAH68974 0 99.9 Splicing factor...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004871 896 1195 PF03178 CPSF A subunit
ScanRegExp IPR003006 323 329 PS00290 Immunoglobulin/major histocompatibility complex motif
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name Stanford G3
Primer_f GGAATCAGGAGTTGTCACCA
Primer_r AAACCACAGGAGTCAATCAG
PCR product length 124 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp