Gene/Protein Characteristic Table for KIAA0026
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00372
Accession No D14812
Description mortality factor 4 like 2, transcript variant 2
Clone name ha00640
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (1826 bp)
Predicted protein sequence (288 aa)
Flexi ORF Clone FXC00372
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0026 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 1826 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 654 bp
Genome contig ID gi89161218r_102717089
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTCAGATCTTAAATAAAATTTGTTTCTAAATTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGCAAGTAATTTGTAGTGTGCCTTTCATGTTACTGGTTGGTATTCTGG
Features of the protein sequence
Description

Length: 288 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAH91151 1.2e-103 99.7 hypothetical pr...
Pongo abelii
BAG54326 1.4e-103 99.7 unnamed protein...
Homo sapiens
Q4R578 2.7e-103 99.7 Mortality facto...
Macaca fascicularis
BAD97224 2.7e-103 99.7 MORF-related ge...
Homo sapiens
XP_538122 1.6e-102 98.6 similar to Mort...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR008676 15 276 PF05712 MRG
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name Stanford G3
Primer_f CCTCCTCAGGAAAGAAGACA
Primer_r GCTGAGGTGCTTCGCTGGTA
PCR product length 180 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp