KIAA0036

Product ID	ORK00379
Accession No	D25278
Description	IQ motif containing B1, transcript variant 1
Clone name	ha02085
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2535 bp) Predicted protein sequence (632 aa)
HaloTag ORF Clone	FHC00379
Flexi ORF Clone	FXC00379
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0036 by Kazusa Mouse cDNA Project

Length: 2535 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	582 bp
Genome contig ID	gi89161205r_122871300
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- AATGCATTCTTTCTATTAAACTGTGAGAACTACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTACTGTTTCCCTTTTTGTCTTTTCTCCTAGGAATCTCAAAGCTAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	122971300	123036563	15	99.4	Perfect prediction

Length: 632 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001150926	0	98.6	nephrocystin 5 ...	Pan troglodytes
Q15051	0	100.0	IQ calmodulin-b...	Homo sapiens
AAW47233	0	99.8	nephrocystin 5 ...	Homo sapiens
XP_001502301	2.1e-203	89.8	IQ motif contai...	Equus caballus
XP_535758	1.6e-200	88.6	similar to IQ c...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032945	0.00051	23.8	KIAA1119

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	329	349	PF00612	IQ calmodulin-binding region
HMMPfam	IPR000048	422	442	PF00612	IQ calmodulin-binding region
HMMSmart	IPR000048	327	349	SM00015	IQ calmodulin-binding region
HMMSmart	IPR000048	420	442	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	328	357	PS50096	IQ calmodulin-binding region
ProfileScan	IPR000048	421	450	PS50096	IQ calmodulin-binding region

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CCTAGCGAAGTGCCGTAAGA
Primer_r	GCTCCCTACTGACCACATCT
PCR product length	155 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles