Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00388 |
---|---|
Accession No | D31762 |
Description | translocation associated membrane protein 2 |
Clone name | ha00909 |
Vector information | |
cDNA sequence | DNA sequence (6974 bp) Predicted protein sequence (384 aa) |
HaloTag ORF Clone |
FHC00388
|
Flexi ORF Clone | FXC00388 |
Source | Myeloblast cell line (KG-1) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 5786 bp |
---|---|
Genome contig ID | gi89161210r_52370166 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 52470166 | 52549747 | 11 | 99.2 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013599 | 59 | 125 | PF08390 | TRAM1-like protein |
IPR005547 | 146 | 341 | PF03798 | Longevity-assurance protein (LAG1) | |
HMMSmart | IPR006634 | 126 | 335 | SM00724 | TRAM |
ProfileScan | IPR006634 | 126 | 335 | PS50922 | TRAM |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 43 | LVLCVLIGLMFEVTAKTAFLFIL | 65 | PRIMARY | 23 | 2 | 87 | KDLVTILFYIFITIILHAVVQEY | 109 | PRIMARY | 23 | 3 | 132 | GQLVVFHFTSVIWCFYVVVTEGY | 154 | SECONDARY | 23 | 4 | 170 | LPFQVKFFYLCQLAYWLHALPEL | 192 | SECONDARY | 23 | 5 | 209 | ICLYLVHIAGAYLLNLSRLGLIL | 231 | PRIMARY | 23 | 6 | 262 | WAAVFGVTRLFILTLAVLAIGFG | 284 | PRIMARY | 23 | 7 | 300 | FNTLFCRLCVLLLVCAAQAWLMW | 322 | PRIMARY | 23 |
---|
Panel name | Stanford G3 |
---|---|
Primer_f | CAGAAGGATGGTGTGAACTCG |
Primer_r | CTGCTGTTTGGTTTGGTTTTG |
PCR product length | 273 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |