KIAA0058

Product ID	ORK01657
Accession No	D31767
Description	DAZ associated protein 2, transcript variant 1
Clone name	ha01532
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1897 bp) Predicted protein sequence (181 aa)
HaloTag ORF Clone	FHC01657
Flexi ORF Clone	FXC01657
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0058 by Kazusa Mouse cDNA Project

Length: 1897 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1321 bp
Genome contig ID	gi89161190f_49818890
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTATTTTGAAGATTTGAATAAAGTGATGAAGTTGC
Flanking genome sequence (104942 - 104991)	----+--------+--------+--------+--------+----* ATTACACCTCACTGCAAGGATTCTTTACTTAGCTTGTTTTTAGATTTCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	49918890	49923830	4	100.0	Perfect prediction

Length: 181 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI29743	7.7e-52	99.4	hypothetical pr...	Pongo abelii
Q9DCP9	7.7e-52	99.4	DAZ-associated ...	Mus musculus
ACJ06404	7.7e-52	99.4	DAZ-associated ...	Sus scrofa
Q4R5H7	1.1e-51	99.4	DAZ-associated ...	Macaca fascicularis
AAR11454	1.1e-51	99.4	DAZAP2 [Homo sa...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	80	181	PD093875	NULL

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CACTTCTCCCCACTCGTCATC
Primer_r	TTGGGTTAGGTTCGTGTATGC
PCR product length	176 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles