Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00394 |
---|---|
Accession No | D31885 |
Description | ADP-ribosylation factor-like 6 interacting protein 1 |
Clone name | ha01508 |
Vector information | |
cDNA sequence | DNA sequence (2272 bp) Predicted protein sequence (226 aa) |
HaloTag ORF Clone |
FHC00394
|
Flexi ORF Clone | FXC00394 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0069
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1591 bp |
---|---|
Genome contig ID | gi51511732r_18610517 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99967 - 99918) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | r | 18710484 | 18720358 | 6 | 99.2 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 42 | 214 | PD352110 | NULL |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | VRVSVGGLVGEVACACRDCIPET | 23 | SECONDARY | 23 | 2 | 65 | AWFPPAIMGVVSLVFLIIYYLDP | 87 | PRIMARY | 23 | 3 | 93 | VSCFVMFLCLADYLVPILAPRIF | 115 | PRIMARY | 23 | 4 | 160 | YFMTMIVSLAAVAWVGQQVHNLL | 182 | PRIMARY | 23 | 5 | 184 | TYLIVTSLLLLPGLNQHGIILKY | 206 | PRIMARY | 23 |
---|
Panel name | Stanford G3 |
---|---|
Primer_f | GCAGACTTGAGGTGATGATAG |
Primer_r | CAATGGGCACCACTGTTCACA |
PCR product length | 181 bp |
PCR conditions | 95 °C15 sec68 °C60 sec30 cycles |