KIAA0073

Product ID	ORK00009
Accession No	D38552
Description	peptidylprolyl isomerase domain and WD repeat containing 1, transcript variant 1
Clone name	ha01539
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2091 bp) Predicted protein sequence (645 aa)
HaloTag ORF Clone	FHC00009
Flexi ORF Clone	FXC00009
Source	Myeloblast cell line (KG-1)

Length: 2091 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	152 bp
Genome contig ID	gi51511721f_64794896
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TTGTATTTTTTATTAAAGGCTATTTTTTAAAAATT
Flanking genome sequence (124237 - 124286)	----+--------+--------+--------+--------+----* ACCTTTGACTTTTCTCGCAATATTTCTAATCCTGGGAGGTGATAAATTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	64894896	64919131	11	100.0	Perfect prediction

Length: 645 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96BP3	100.0	Peptidylprolyl ...	Homo sapiens
XP_001164190	99.5	peptidylprolyl ...	Pan troglodytes
XP_001085845	99.4	similar to pept...	Macaca mulatta
Q5NVL7	98.9	Peptidylprolyl ...	Pongo abelii
XP_001492861	97.8	peptidylprolyl ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002130	506	521	PR00153	Peptidyl-prolyl cis-trans isomerase
	IPR002130	532	544	PR00153	Peptidyl-prolyl cis-trans isomerase
	IPR002130	575	590	PR00153	Peptidyl-prolyl cis-trans isomerase
	IPR002130	590	602	PR00153	Peptidyl-prolyl cis-trans isomerase
	IPR002130	603	618	PR00153	Peptidyl-prolyl cis-trans isomerase
HMMPfam	IPR001680	88	116	PF00400	WD40 repeat
	IPR001680	122	160	PF00400	WD40 repeat
	IPR001680	283	307	PF00400	WD40 repeat
	IPR002130	492	645	PF00160	Peptidyl-prolyl cis-trans isomerase
HMMSmart	IPR001680	79	116	SM00320	WD40 repeat
	IPR001680	121	160	SM00320	WD40 repeat
	IPR001680	210	250	SM00320	WD40 repeat
	IPR001680	268	307	SM00320	WD40 repeat
ProfileScan	IPR001680	85	169	PS50294	WD40 repeat
	IPR001680	128	169	PS50082	WD40 repeat
	IPR002130	489	644	PS50072	Peptidyl-prolyl cis-trans isomerase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AGTGGTAGCGATTTTCAGCAG
Primer_r	CTCATCGTTCTCCTGGGACAC
PCR product length	120 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles