Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00402 |
---|---|
Accession No | D42042 |
Description | lysosomal protein transmembrane 5 |
Clone name | ha01520 |
Vector information | |
cDNA sequence | DNA sequence (2169 bp) Predicted protein sequence (269 aa) |
HaloTag ORF Clone |
FHC00402
|
Flexi ORF Clone | FXC00402 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0085
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1359 bp |
---|---|
Genome contig ID | gi89161185r_30877903 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 30977903 | 31003200 | 8 | 99.2 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004687 | 36 | 268 | PF03821 | Golgi 4-transmembrane spanning transporter |
HMMTigr | IPR004687 | 11 | 269 | TIGR00799 | Golgi 4-transmembrane spanning transporter |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 24 | VRIATTALAIYHVIMSVLLFIEH | 46 | PRIMARY | 23 | 2 | 71 | ISSFLLITMLFIISLSLLIGVVK | 93 | PRIMARY | 23 | 3 | 99 | LLPFLSLQIMDYLLCLLTLLGSY | 121 | PRIMARY | 23 | 4 | 141 | FPLMTLQLLDFCLSILTLCSSYM | 163 | SECONDARY | 23 | 5 | 191 | FIKMMIIFSIAFITVLIFKVYMF | 213 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | TGCTCACCTATTCAGTTGCTC |
Primer_r | CTTTGACTGAACTAACCTGTG |
PCR product length | 243 bp |
PCR conditions | 95 °C15 sec62 °C120 sec30 cycles |