KIAA0113

Product ID	ORK00020
Accession No	D30755
Description	TNFAIP3 interacting protein 1, transcript variant 5
Clone name	ha01652s1
Vector information	The cDNA fragment was originally inserted at the EcoRV-NotI ... The cDNA fragment was originally inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) without using any linker or adapter and a RT-PCR product (1-1405) was subcloned upstream of the cDNA (1406-2677). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA GGCCGCGGGA ATTCGATT-5' end of cDNA.
cDNA sequence	DNA sequence (2677 bp) Predicted protein sequence (636 aa)
HaloTag ORF Clone	FHC00020
Flexi ORF Clone	FXC00020
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0113 by Kazusa Mouse cDNA Project
Note	We replaced ha01652, former representative clones for KIAA0113 with ha01652s1. (2002/5/10)

Length: 2677 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	766 bp
Genome contig ID	gi51511721r_150289701
PolyA signal sequence (CATAAA,-24)	+--------+--------+----*----+---- CGAATCATGGACATAAATCCAAGTTGAAGAAGATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATTCTGACTCATGTTCATTTATGCGCTAATGTTCCCCTGTCAACCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	150389701	150424849	17	99.7	Perfect prediction

Length: 636 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAG42154	3.5e-187	99.8	virion-associat...	Homo sapiens
AAH12133	4.8e-187	99.8	TNFAIP3 interac...	Homo sapiens
XP_001167590	1.6e-186	99.5	Nef-associated ...	Pan troglodytes
BAF83688	2.1e-186	99.5	unnamed protein...	Homo sapiens
BAF48799	5.3e-185	100.0	Nef-associated ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 5

Experimental conditions

Panel name	Stanford G3
Primer_f	CCCCTTCCTTCAAAACCTCCC
Primer_r	AGACAAACCCACACTTCCCAC
PCR product length	159 bp
PCR conditions	95 °C15 sec66 °C120 sec30 cycles