Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00413 |
---|---|
Accession No | D29643 |
Description | dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic) |
Clone name | ha00643 |
Vector information | |
cDNA sequence | DNA sequence (1668 bp) Predicted protein sequence (456 aa) |
HaloTag ORF Clone |
FHC00413
|
Flexi ORF Clone | FXC00413 |
Source | Myeloblast cell line (KG-1) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 191 bp |
---|---|
Genome contig ID | gi89161185r_20751268 |
PolyA signal sequence (TATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 20851268 | 20860587 | 11 | 99.6 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR005013 | 26 | 455 | PF03345 | Dolichyl-diphosphooligosaccharide-protein glycosyltransferase 48kDa subunit |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 22 | TAARAWALFWLLLPLLGAVCASG | 44 | PRIMARY | 23 | 2 | 431 | SAFPMMLGLFIFSIVFLHM | 449 | PRIMARY | 19 |
---|
Panel name | Stanford G3 |
---|---|
Primer_f | GGGGGTTATTAGGATTGGTGG |
Primer_r | ACCCCTTGGCTCTCAGTGTTG |
PCR product length | 103 bp |
PCR conditions | 95 °C15 sec66 °C120 sec30 cycles |