Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07735 |
---|---|
Accession No | D50923 |
Description | URB2 ribosome biogenesis 2 homolog (S. cerevisiae) |
Clone name | ha03502s1 |
Vector information | |
cDNA sequence | DNA sequence (5613 bp) Predicted protein sequence (1527 aa) |
HaloTag ORF Clone |
FHC07735
|
Flexi ORF Clone | FXC07735 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0133
by Kazusa Mouse cDNA Project
|
Note | We replaced ha03502, former representative clones for KIAA0133 with ha03502s1. (2008/8/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 902 bp |
---|---|
Genome contig ID | gi89161185f_227728604 |
PolyA signal sequence (CATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (133967 - 134016) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Panel name | Stanford G3 |
---|---|
Primer_f | TGCCTGCTCCTCCTGTGTTAG |
Primer_r | AAGATACTCCAAGGTGACAAC |
PCR product length | 214 bp |
PCR conditions | 95 °C15 sec62 °C120 sec30 cycles |