KIAA0140

Product ID	ORK00424
Accession No	D50930
Description	family with sequence similarity 53, member B
Clone name	ha00520
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5429 bp) Predicted protein sequence (439 aa)
HaloTag ORF Clone	FHC00424
Flexi ORF Clone	FXC00424
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0140 by Kazusa Mouse cDNA Project

Length: 5429 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3948 bp
Genome contig ID	gi89161187r_126197853
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTACTGTGTAAATAAAGCTTCCTGGTTCAATACCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTGCCTGGTGCCAGCTGTGTGGTTTCTGTTGGGTGTGGTGAACTGGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	126297853	126422609	5	99.2	Perfect prediction

Length: 439 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09619	2.9e-175	100.0	FAM53B protein ...	synthetic construct
Q14153	6e-175	99.8	Protein FAM53B.	Homo sapiens
XP_001083541	1.2e-169	97.2	hypothetical pr...	Macaca mulatta
Q8BGR5	1.1e-147	85.1	Protein FAM53B.	Mus musculus
XP_854058	1.2e-145	88.2	hypothetical pr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 10

Experimental conditions

Panel name	Genebridge 4
Primer_f	TAATGGCAGACCGAAGTGGAG
Primer_r	GCCTATGTGCTATCTGTCGCC
PCR product length	140 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles