Order Kazusa clone(s) from : ![]() |
Product ID | ORK05777 |
---|---|
Accession No | D79988 |
Description | kinetochore associated 1 |
Clone name | ha02362 |
Vector information | |
cDNA sequence | DNA sequence (6942 bp) Predicted protein sequence (2228 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0166
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 149 bp |
---|---|
Genome contig ID | gi89161190f_121477762 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (199117 - 199166) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 121577762 | 121676877 | 64 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ScanRegExp | IPR004827 | 1736 | 1750 | PS00036 | Basic-leucine zipper (bZIP) transcription factor |
Panel name | Genebridge 4 |
---|---|
Primer_f | AAGAGCATATGAACACGGGCC |
Primer_r | TCAGAATTTCACAGGGAGCAG |
PCR product length | 279 (0.5k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |