KIAA0166

Gene/Protein Characteristic Table for KIAA0166

Order Kazusa clone(s) from :

Product ID	ORK05777
Accession No	D79988
Description	kinetochore associated 1
Clone name	ha02362
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6942 bp) Predicted protein sequence (2228 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0166 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 6942 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	149 bp
Genome contig ID	gi89161190f_121477762
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ATTACCCCACATGTAATAAATAAAACAATATGAGC
Flanking genome sequence (199117 - 199166)	----+--------+--------+--------+--------+----* ATAATTGCCCCATAAAGAACTCATGTCCTGAATTAATAAGTCTTTTCATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	121577762	121676877	64	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 2228 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P50748	100.0	Kinetochore-ass...	Homo sapiens
EAW98333	100.0	kinetochore ass...	Homo sapiens
XP_001168340	99.5	Rough Deal homo...	Pan troglodytes
XP_001492639	91.6	similar to Kine...	Equus caballus
Q8C3Y4	81.0	Kinetochore-ass...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR004827	1736	1750	PS00036	Basic-leucine zipper (bZIP) transcription factor

Expression profile

Description

Northern blot

Experimental conditions

Primer_f
Primer_r
PCR conditions	test

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	Genebridge 4
Primer_f	AAGAGCATATGAACACGGGCC
Primer_r	TCAGAATTTCACAGGGAGCAG
PCR product length	279 (0.5k) bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp