|
Order Kazusa clone(s) from : |
| Product ID | ORK05577 |
|---|---|
| Accession No | D79998 |
| Description | potassium channel tetramerization domain containing 2 |
| Clone name | ha03941 |
| Vector information | |
| cDNA sequence | DNA sequence (3635 bp) Predicted protein sequence (265 aa) |
| Source | Myeloblast cell line (KG-1) |
Length: 3635 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2837 bp |
|---|---|
| Genome contig ID | gi51511734f_70455104 |
| PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (118472 - 118521) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 17 | f | 70554935 | 70573574 | 6 | 99.1 | Perfect prediction |
Length: 265 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Chromosome No. 17
Experimental conditions| Panel name | Genebridge 4 |
|---|---|
| Primer_f | GTAACTGCTCTTGGGGATGTC |
| Primer_r | CAAACAGGAACAGAGGGTGCC |
| PCR product length | 154 bp |
| PCR conditions | 95 °C 15 sec 68 °C 60 sec 30 cycles |