KIAA0176

Product ID	ORK05577
Accession No	D79998
Description	potassium channel tetramerization domain containing 2
Clone name	ha03941
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3635 bp) Predicted protein sequence (265 aa)
Source	Myeloblast cell line (KG-1)

Length: 3635 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2837 bp
Genome contig ID	gi51511734f_70455104
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TTTGTGTGAATAAAGATATGAAACTTCTGAATCTC
Flanking genome sequence (118472 - 118521)	----+--------+--------+--------+--------+----* AAGAACTGTGGTGTGTTTTCCATTACTGCAGTCTCCTGGTTCCCACTGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	70554935	70573574	6	99.1	Perfect prediction

Length: 265 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14681	3.2e-87	100.0	BTB/POZ domain-...	Homo sapiens
AAI60142	1.1e-86	99.6	Potassium chann...	synthetic construct
XP_001138510	4.2e-86	99.2	potassium chann...	Pan troglodytes
XP_001092438	3e-85	98.1	similar to pota...	Macaca mulatta
XP_852044	1.5e-84	97.3	similar to Pota...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003131	76	169	PF02214	K+ channel tetramerisation
HMMSmart	IPR000210	74	177	SM00225	BTB/POZ-like

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GTAACTGCTCTTGGGGATGTC
Primer_r	CAAACAGGAACAGAGGGTGCC
PCR product length	154 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles