KIAA0258

Product ID	ORK00481
Accession No	D87447
Description	RGP1 homolog, RAB6A GEF complex partner 1
Clone name	ha07053
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6313 bp) Predicted protein sequence (410 aa)
HaloTag ORF Clone	FHC00481
Flexi ORF Clone	FXC00481
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0258 by Kazusa Mouse cDNA Project

Length: 6313 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	5052 bp
Genome contig ID	gi89161216f_35639340
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- AAGTAATTTTGGTGGATTTTTAAAAATAAAAAAAT
Flanking genome sequence (108584 - 108633)	----+--------+--------+--------+--------+----* AAAAATAGAAAAGTTGCACAATCTAATTCAATATTTGACTTAAAACCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	35739340	35747922	9	99.2	Perfect prediction

Length: 410 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_001073965	2.3e-172	100.0	RGP1 retrograde...	Homo sapiens
XP_001084588	2.1e-171	99.8	hypothetical pr...	Macaca mulatta
XP_001497777	6.8e-164	97.7	RGP1 retrograde...	Equus caballus
BAF82255	7.5e-164	99.7	unnamed protein...	Homo sapiens
XP_001928680	2.1e-162	98.7	RGP1 retrograde...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014848	59	351	PF08737	Rgp1

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TTAGGAGTAGGGGGAGTTATG
Primer_r	GCAGACAGTAATCCAAGACGC
PCR product length	136 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles