KIAA0263

Product ID	ORK01592
Accession No	D87452
Description	inositol hexakisphosphate kinase 1, transcript variant 1
Clone name	pj01112
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4455 bp) Predicted protein sequence (462 aa)
HaloTag ORF Clone	FHC01592
Flexi ORF Clone	FXC01592
Source	Human brain (hippocampus)
Rouge ID	mKIAA0263 by Kazusa Mouse cDNA Project
Note	We replaced ha07068, former representative clones for KIAA0263 with pj01112. (2001/10/06)

Length: 4455 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2827 bp
Genome contig ID	gi89161205r_49636732
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTCGTGTATGTCAAAAATAAAGCCGCTAGAAACGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGCGAGTCTGTCTTTGTGAAAATCCCGTGGCCCGGGAGCCTTCCCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	49736732	49798964	6	99.2	Perfect prediction

Length: 462 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q92551	1e-187	100.0	Inositol hexaki...	Homo sapiens
XP_001107338	2.5e-187	99.8	similar to inos...	Macaca mulatta
CAH90071	9.2e-185	98.9	hypothetical pr...	Pongo abelii
XP_001497210	2.1e-182	97.3	inositol hexaph...	Equus caballus
XP_850553	5.9e-181	96.4	similar to inos...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005522	156	455	PF03770	Inositol polyphosphate kinase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGCGTTTGCTTTGGACCTTGC
Primer_r	GACATACACGACCTCAGACAC
PCR product length	110 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles