Order Kazusa clone(s) from : ![]() |
Product ID | ORK01592 |
---|---|
Accession No | D87452 |
Description | inositol hexakisphosphate kinase 1, transcript variant 1 |
Clone name | pj01112 |
Vector information | |
cDNA sequence | DNA sequence (4455 bp) Predicted protein sequence (462 aa) |
HaloTag ORF Clone |
FHC01592
![]() |
Flexi ORF Clone | FXC01592 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA0263
by Kazusa Mouse cDNA Project
|
Note | We replaced ha07068, former representative clones for KIAA0263 with pj01112. (2001/10/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2827 bp |
---|---|
Genome contig ID | gi89161205r_49636732 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 49736732 | 49798964 | 6 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | TGCGTTTGCTTTGGACCTTGC |
Primer_r | GACATACACGACCTCAGACAC |
PCR product length | 110 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |