Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00502 |
---|---|
Accession No | AB002314 |
Description | FERM and PDZ domain containing 4 |
Clone name | fg06820 |
Vector information | |
cDNA sequence | DNA sequence (6352 bp) Predicted protein sequence (1379 aa) |
HaloTag ORF Clone |
FHC00502
|
Flexi ORF Clone | FXC00502 |
Source | Human fetal brain |
Rouge ID |
mKIAA0316
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00253, former representative clones for KIAA0316 with fg06820. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1877 bp |
---|---|
Genome contig ID | gi89161218f_11966506 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (683946 - 683995) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001478 | 144 | 209 | PF00595 | PDZ/DHR/GLGF |
HMMSmart | IPR001478 | 142 | 212 | SM00228 | PDZ/DHR/GLGF |
IPR000299 | 259 | 481 | SM00295 | Band 4.1 | |
ProfileScan | IPR001202 | 90 | 123 | PS50020 | WW/Rsp5/WWP |
IPR001478 | 135 | 212 | PS50106 | PDZ/DHR/GLGF | |
IPR000299 | 261 | 576 | PS50057 | Band 4.1 |
RT-PCR |
---|
Primer_f | GATTTTGTCCCAGTACTACGC |
---|---|
Primer_r | CAGTAATGTAGACCAGACCAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GATTTTGTCCCAGTACTACGC |
Primer_r | CAGTAATGTAGACCAGACCAC |
PCR product length | 148 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |