KIAA0353

Product ID	ORK00513
Accession No	AB002351
Description	synemin, intermediate filament protein, transcript variant A
Clone name	hg01758y1
Vector information	The cDNA fragment was originally inserted at ApaI-NotI site ... The cDNA fragment was originally inserted at ApaI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGACTAGTA C-5' end of cDNA.
cDNA sequence	DNA sequence (7381 bp) Predicted protein sequence (1614 aa)
HaloTag ORF Clone	FHC00513
Flexi ORF Clone	FXC00513
Source	Human adult brain
Rouge ID	mKIAA0353 by Kazusa Mouse cDNA Project
Note	We replaced hg01758, former representative clones for KIAA0353 with hg01758y1. (2002/12/27)

Length: 7381 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2525 bp
Genome contig ID	gi51511731f_97362771
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- ATGTCACAAGAATGTGCAAAAATAAAAATCTGAGG
Flanking genome sequence (130542 - 130591)	----+--------+--------+--------+--------+----* AAAAAACCCACATTGTTCCTAAAGAGAATGAATATTTTCAGTAGATTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	97462771	97493311	4	99.0	Perfect prediction

Length: 1614 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI51244	100.0	Desmuslin [Homo...	Homo sapiens
O15061	99.9	Synemin; Desmuslin.	Homo sapiens
EAX02231	99.7	desmuslin, isof...	Homo sapiens
CAC83859	98.3	synemin [Homo s...	Homo sapiens
XP_001108469	93.7	desmuslin [Maca...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020652	5.6e-10	25.1	KIAA0845

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001664	59	370	PF00038	Intermediate filament protein
ScanRegExp	IPR001664	357	365	PS00226	Intermediate filament protein

Primer_f	TCAAAACCACCAGTAGGAAAC
Primer_r	CTGCACACAAGAGAAATCAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCAAAACCACCAGTAGGAAAC
Primer_r	CTGCACACAAGAGAAATCAAC
PCR product length	128 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles