Gene/Protein Characteristic Table for KIAA0372
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01594
Accession No AB002370
Description tetratricopeptide repeat domain 37
Clone name hh00270
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5704 bp)
Predicted protein sequence (1568 aa)
Flexi ORF Clone FXC01594
Source Human adult brain
Rouge ID mKIAA0372 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5704 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1568 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001918367 0 92.6 similar to Tetr...
Equus caballus
XP_536294 0 92.0 similar to CG87...
Canis lupus fam...
AAI56422 0 84.7 Tetratricopepti...
synthetic construct
XP_001059136 0 83.9 similar to CG87...
Rattus norvegicus
XP_001364956 0 82.9 similar to pol ...
Monodelphis dom...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001440 10 43 PF00515 Tetratricopeptide TPR_1
IPR001440 44 77 PF00515 Tetratricopeptide TPR_1
IPR001440 310 343 PF00515 Tetratricopeptide TPR_1
IPR013105 424 457 PF07719 Tetratricopeptide TPR_2
IPR006597 458 494 PF08238 Sel1-like
IPR006597 497 529 PF08238 Sel1-like
IPR001440 568 601 PF00515 Tetratricopeptide TPR_1
IPR001440 602 635 PF00515 Tetratricopeptide TPR_1
IPR001440 811 828 PF00515 Tetratricopeptide TPR_1
IPR001440 865 898 PF00515 Tetratricopeptide TPR_1
IPR001440 984 1017 PF00515 Tetratricopeptide TPR_1
IPR001440 1062 1088 PF00515 Tetratricopeptide TPR_1
IPR001440 1404 1437 PF00515 Tetratricopeptide TPR_1
HMMSmart IPR013026 10 43 SM00028 Tetratricopeptide region
IPR013026 44 77 SM00028 Tetratricopeptide region
IPR013026 276 309 SM00028 Tetratricopeptide region
IPR013026 310 343 SM00028 Tetratricopeptide region
IPR013026 424 457 SM00028 Tetratricopeptide region
IPR013026 458 496 SM00028 Tetratricopeptide region
IPR013026 497 531 SM00028 Tetratricopeptide region
IPR013026 568 601 SM00028 Tetratricopeptide region
IPR013026 602 635 SM00028 Tetratricopeptide region
IPR013026 636 669 SM00028 Tetratricopeptide region
IPR013026 865 898 SM00028 Tetratricopeptide region
IPR013026 984 1017 SM00028 Tetratricopeptide region
IPR013026 1055 1088 SM00028 Tetratricopeptide region
IPR013026 1404 1437 SM00028 Tetratricopeptide region
ProfileScan IPR013026 10 77 PS50293 Tetratricopeptide region
IPR013026 44 77 PS50005 Tetratricopeptide region
IPR013026 276 309 PS50005 Tetratricopeptide region
IPR013026 276 669 PS50293 Tetratricopeptide region
IPR013026 310 343 PS50005 Tetratricopeptide region
IPR013026 390 423 PS50005 Tetratricopeptide region
IPR013026 424 457 PS50005 Tetratricopeptide region
IPR013026 568 601 PS50005 Tetratricopeptide region
IPR013026 602 635 PS50005 Tetratricopeptide region
IPR013026 636 669 PS50005 Tetratricopeptide region
IPR013026 794 898 PS50293 Tetratricopeptide region
IPR013026 865 898 PS50005 Tetratricopeptide region
IPR013026 984 1017 PS50005 Tetratricopeptide region
IPR013026 1055 1088 PS50005 Tetratricopeptide region
IPR013026 1055 1088 PS50293 Tetratricopeptide region
IPR013026 1404 1437 PS50005 Tetratricopeptide region
IPR013026 1404 1437 PS50293 Tetratricopeptide region
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GGGTTTTTATTGGCGTTGCTG
Primer_r GCTAGTAATTGGTCTGGCTCT
PCR conditions 95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name GeneBridge 4
Primer_f GGGTTTTTATTGGCGTTGCTG
Primer_r GCTAGTAATTGGTCTGGCTCT
PCR product length 100 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp