KIAA0397

Product ID	ORK01082
Accession No	AB007857
Description	small G protein signaling modulator 2, transcript variant 2
Clone name	fj00010
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4734 bp) Predicted protein sequence (1016 aa)
HaloTag ORF Clone	FHC01082
Flexi ORF Clone	FXC01082
Source	Human fetal brain
Rouge ID	mKIAA0397 by Kazusa Mouse cDNA Project
Note	We replaced hg00184, former representative clones for KIAA0397 with fj00010. (2002/5/10)

Length: 4734 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	1538 bp
Genome contig ID	gi51511734f_2087639
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTAACAGACCAATAAACAACATTTGTCAACACTGG
Flanking genome sequence (143465 - 143514)	----+--------+--------+--------+--------+----* AGCCTCTGGGACTGGACACTGAGAGACCACGTGCCTTCTTTAAGCTCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	2187558	2231102	23	99.7	Perfect prediction

Length: 1016 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O43147	100.0	Small G protein...	Homo sapiens
EAW90547	99.8	RUN and TBC1 do...	Homo sapiens
EAW90545	99.6	RUN and TBC1 do...	Homo sapiens
BAG58030	99.9	unnamed protein...	Homo sapiens
EDM05191	93.0	RUN and TBC1 do...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075821	1.4e-56	50.8	KIAA1941
AB037743	0.00039	26.0	KIAA1322

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004012	52	199	PF02759	RUN
HMMPfam	IPR000195	768	975	PF00566	RabGAP/TBC
HMMSmart	IPR004012	138	198	SM00593	RUN
HMMSmart	IPR000195	573	976	SM00164	RabGAP/TBC
ProfileScan	IPR004012	44	201	PS50826	RUN
ProfileScan	IPR000195	576	949	PS50086	RabGAP/TBC

Primer_f	TCTGCTCCTCACAAAACCACG
Primer_r	ATTGTCCATCCTTGTTGTCCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCTGCTCCTCACAAAACCACG
Primer_r	ATTGTCCATCCTTGTTGTCCG
PCR product length	99 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles