KIAA0398

Gene/Protein Characteristic Table for KIAA0398

Order Kazusa clone(s) from :

Product ID	ORK00528
Accession No	AB007858
Description	RNA (guanine-7-) methyltransferase, transcript variant 2
Clone name	hg00376
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6203 bp) Predicted protein sequence (476 aa)
HaloTag ORF Clone	FHC00528
Flexi ORF Clone	FXC00528
Source	Human adult brain
Rouge ID	mKIAA0398 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 6203 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4576 bp
Genome contig ID	gi51511735f_13620625
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTCATTGTGTGAATAAACCACATACTGTTTATCTG
Flanking genome sequence (133931 - 133980)	----+--------+--------+--------+--------+----* ACAGCTGTTTGGTTCATTTACCATTTGGAAACTAGTACTGATCCAGATAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	13716704	13754554	12	99.3	Perfect prediction

Features of the protein sequence

Description

Length: 476 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAA82447	1.4e-182	99.8	RNA (guanine-N7...	Homo sapiens
XP_001171239	1.4e-181	99.2	RNA (guanine-7-...	Pan troglodytes
BAA74463	2.1e-178	98.3	mRNA (guanine-7...	Homo sapiens
BAF85250	4.9e-178	98.1	unnamed protein...	Homo sapiens
Q4R7K1	3.4e-177	96.4	mRNA cap guanin...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004971	136	476	PF03291	mRNA capping enzyme

Expression profile

Description

RT-PCR

Experimental conditions

Primer_f	GAAACCAGATACGAAGAATGC
Primer_r	ATACAATCGGCACCCCAGAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 18

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GAAACCAGATACGAAGAATGC
Primer_r	ATACAATCGGCACCCCAGAAG
PCR product length	156 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp