KIAA0419

Product ID	ORK01085
Accession No	AB007879
Description	centriolar coiled coil protein 110kDa, transcript variant 2
Clone name	hh01019
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hh01019 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (5399 bp) Predicted protein sequence (1000 aa)
HaloTag ORF Clone	FHC01085
Flexi ORF Clone	FXC01085
Source	Human adult brain
Rouge ID	mKIAA0419 by Kazusa Mouse cDNA Project

Length: 5399 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2132 bp
Genome contig ID	gi51511732f_19342779
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAGGCAAAAAGCAAAATAAACTTTTCATCTTAAAG
Flanking genome sequence (129450 - 129499)	----+--------+--------+--------+--------+----* AAAATCTAGTTTGATTGTTTTTATTTACCAGGGGAAGGACTATTAAGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	19442779	19472227	15	99.3	Perfect prediction

Length: 1000 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11187	100.0	centrosomal pro...	synthetic construct
AAH36654	99.8	CP110 protein [...	Homo sapiens
CAH18111	98.2	hypothetical pr...	Homo sapiens
O43303	98.1	Centrosomal pro...	Homo sapiens
BAG62153	98.1	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CAGTACCATTTGAGCCATTCG
Primer_r	AGAACAGTATCAGCACACAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CAGTACCATTTGAGCCATTCG
Primer_r	AGAACAGTATCAGCACACAGC
PCR product length	104 (1.6k) bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles