Gene/Protein Characteristic Table for KIAA0427
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00535
Accession No AB007887
Description CBP80/20-dependent translation initiation factor, transcript variant 1
Clone name hh01382
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5737 bp)
Predicted protein sequence (601 aa)
Flexi ORF Clone FXC00535
Source Human adult brain
Rouge ID mKIAA0427 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5737 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 601 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EDL09491 1.4e-209 93.3 gene model 672,...
Mus musculus
XP_001086969 4.8e-208 94.1 hypothetical pr...
Macaca mulatta
XP_001087210 3e-207 93.8 hypothetical pr...
Macaca mulatta
BAG53180 2.1e-194 99.8 unnamed protein...
Homo sapiens
BAE90729 3.4e-186 99.0 unnamed protein...
Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003890 379 580 PF02854 MIF4G-like
HMMSmart IPR003890 379 580 SM00543 MIF4G-like
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GGAAAGCAGGACATACCGACG
Primer_r GCCTTTGAGGACACAGATCAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 18
Experimental conditions
Panel name GeneBridge 4
Primer_f GGAAAGCAGGACATACCGACG
Primer_r GCCTTTGAGGACACAGATCAG
PCR product length 89 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp