Gene/Protein Characteristic Table for KIAA0428
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00074
Accession No AB007888
Description muscleblind-like splicing regulator 1, transcript variant 2
Clone name hh01409
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5940 bp)
Predicted protein sequence (373 aa)
Flexi ORF Clone FXC00074
Source Human adult brain
Rouge ID mKIAA0428 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5940 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 373 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW78776 7.1e-138 100.0 muscleblind-lik...
Homo sapiens
AAI42167 7e-137 99.7 MBNL1 protein [...
Bos taurus
Q5ZKW9 5.3e-136 98.9 Muscleblind-lik...
Gallus gallus
AAK94915 1.8e-121 96.9 muscleblind 41k...
Homo sapiens
EDM14833 1.8e-120 96.6 rCG50114, isofo...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000571 17 43 PF00642 Zinc finger
IPR000571 51 75 PF00642 Zinc finger
IPR000571 183 209 PF00642 Zinc finger
IPR000571 219 243 PF00642 Zinc finger
HMMSmart IPR000571 17 43 SM00356 Zinc finger
IPR000571 50 75 SM00356 Zinc finger
IPR000571 182 209 SM00356 Zinc finger
IPR000571 219 243 SM00356 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AGCAGTCGGTAGAAGAAGCGG
Primer_r CTTCCATCTCATGCGTTCAGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f AGCAGTCGGTAGAAGAAGCGG
Primer_r CTTCCATCTCATGCGTTCAGC
PCR product length 208 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp