Gene/Protein Characteristic Table for KIAA0431
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00075
Accession No AB007891
Description ATM interactor, transcript variant 2
Clone name hh01739
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5350 bp)
Predicted protein sequence (719 aa)
Flexi ORF Clone FXC00075
Source Human adult brain
Rouge ID mKIAA0431 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5350 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 2383 bp
Genome contig ID gi51511732f_79531631
PolyA signal sequence
(GATAAA,-21)
+----*----+----*----+----*----+----
TTTGAAAGCCATATGATAAAATGATTTTATTTAAT
Flanking genome sequence
(106823 - 106872)
----+----*----+----*----+----*----+----*----+----*
AATACCCAGTTATTTTCATTGTTTTTTCTTTTGTTCATGAAAATATGCTA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 f 79631631 79638452 3 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 719 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW95550 0 100.0 ATM/ATR-Substra...
Homo sapiens
AAH02701 0 100.0 ATMIN protein [...
Homo sapiens
O43313 0 100.0 ATM interactor;...
Homo sapiens
XP_001108829 0 97.1 similar to ATM/...
Macaca mulatta
BAF83632 0 99.7 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AGGGTACAATTCTGGCTTCTC
Primer_r TAAATGGCAGTGATCTATGGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f AGGGTACAATTCTGGCTTCTC
Primer_r TAAATGGCAGTGATCTATGGC
PCR product length 191 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp