| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK00080 | 
|---|---|
| Accession No | AB007924 | 
| Description | lipid phosphate phosphatase-related protein type 4, transcript variant 1 | 
| Clone name | fh02485 | 
| Vector information | |
| cDNA sequence | DNA sequence (5014 bp) Predicted protein sequence (814 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC00080
     
     
     | 
| Flexi ORF Clone | FXC00080 | 
| Source | Human fetal brain | 
| Rouge ID | 
    mKIAA0455
    
    by Kazusa Mouse cDNA Project
     | 
| Note | We replaced hg00513, former representative clones for KIAA0455 with fh02485. (2005/08/06) | 
 Length: 5014 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 2568 bp | 
|---|---|
| Genome contig ID | gi89161185f_99402440 | 
| PolyA signal sequence (AATAAA,-23)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (145286 - 145335)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 1 | f | 99502440 | 99547724 | 7 | 99.2 | Perfect prediction | 
 
        Length: 814 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| HMMPfam | IPR000326 | 229 | 382 | PF01569 | Phosphoesterase | 
| HMMSmart | IPR000326 | 230 | 374 | SM00014 | Phosphoesterase | 
	Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 116 | TLLPCFYFVELPILASSVVSLYF | 138 | PRIMARY | 23 | 2 | 173 | FLMLLSLAFAGPAITIMVGEGIL | 195 | PRIMARY | 23 | 
|---|
 Experimental conditions| Primer_f | |
|---|---|
| Primer_r | |
| PCR conditions |  °C  sec  °C  sec  cycles![]()  | 
 Chromosome No. 1
 Experimental conditions| Panel name | GeneBridge 4 | 
|---|---|
| Primer_f | ATCAGTAAAGCACAGCCTAAC | 
| Primer_r | AGGTGGTATCTCTTCTTAGTG | 
| PCR product length | 83 bp | 
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |