Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01976 |
---|---|
Accession No | AB007930 |
Description | pogo transposable element with ZNF domain |
Clone name | hg00867 |
Vector information | |
cDNA sequence | DNA sequence (6148 bp) Predicted protein sequence (1355 aa) |
HaloTag ORF Clone |
FHC01976
|
Flexi ORF Clone | FXC01976 |
Source | Human adult brain |
Rouge ID |
mKIAA0461
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 439 | 461 | PF00096 | Zinc finger |
IPR007087 | 564 | 586 | PF00096 | Zinc finger | |
IPR015175 | 961 | 1024 | PF09091 | Centromere protein B | |
IPR004875 | 1062 | 1218 | PF03184 | CENP-B protein | |
HMMSmart | IPR015880 | 439 | 461 | SM00355 | Zinc finger |
IPR015880 | 475 | 498 | SM00355 | Zinc finger | |
IPR015880 | 505 | 528 | SM00355 | Zinc finger | |
IPR015880 | 535 | 558 | SM00355 | Zinc finger | |
IPR015880 | 564 | 586 | SM00355 | Zinc finger | |
IPR015880 | 592 | 614 | SM00355 | Zinc finger | |
IPR015880 | 716 | 739 | SM00355 | Zinc finger | |
IPR015880 | 760 | 785 | SM00355 | Zinc finger | |
IPR006600 | 966 | 1030 | SM00674 | Centromere protein B | |
ProfileScan | IPR007087 | 439 | 466 | PS50157 | Zinc finger |
IPR007087 | 475 | 503 | PS50157 | Zinc finger | |
IPR006600 | 960 | 1030 | PS51253 | Centromere protein B | |
ScanRegExp | IPR007087 | 441 | 461 | PS00028 | Zinc finger |
IPR007087 | 477 | 498 | PS00028 | Zinc finger | |
IPR007087 | 507 | 528 | PS00028 | Zinc finger | |
IPR007087 | 566 | 586 | PS00028 | Zinc finger | |
IPR007087 | 594 | 615 | PS00028 | Zinc finger |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C sec °C sec cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCTACTACTAAGCCATGCAGG |
Primer_r | AGCTGGGGTTCCTGTCTTCTG |
PCR product length | 138 bp |
PCR conditions | 95 °C15 sec68 °C60 sec30 cycles |