Order Kazusa clone(s) from : ![]() |
Product ID | ORK01976 |
---|---|
Accession No | AB007930 |
Description | pogo transposable element with ZNF domain |
Clone name | hg00867 |
Vector information | |
cDNA sequence | DNA sequence (6148 bp) Predicted protein sequence (1355 aa) |
HaloTag ORF Clone |
FHC01976
![]() |
Flexi ORF Clone | FXC01976 |
Source | Human adult brain |
Rouge ID |
mKIAA0461
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 439 | 461 | PF00096 | Zinc finger |
IPR007087 | 564 | 586 | PF00096 | Zinc finger | |
IPR015175 | 961 | 1024 | PF09091 | Centromere protein B | |
IPR004875 | 1062 | 1218 | PF03184 | CENP-B protein | |
HMMSmart | IPR015880 | 439 | 461 | SM00355 | Zinc finger |
IPR015880 | 475 | 498 | SM00355 | Zinc finger | |
IPR015880 | 505 | 528 | SM00355 | Zinc finger | |
IPR015880 | 535 | 558 | SM00355 | Zinc finger | |
IPR015880 | 564 | 586 | SM00355 | Zinc finger | |
IPR015880 | 592 | 614 | SM00355 | Zinc finger | |
IPR015880 | 716 | 739 | SM00355 | Zinc finger | |
IPR015880 | 760 | 785 | SM00355 | Zinc finger | |
IPR006600 | 966 | 1030 | SM00674 | Centromere protein B | |
ProfileScan | IPR007087 | 439 | 466 | PS50157 | Zinc finger |
IPR007087 | 475 | 503 | PS50157 | Zinc finger | |
IPR006600 | 960 | 1030 | PS51253 | Centromere protein B | |
ScanRegExp | IPR007087 | 441 | 461 | PS00028 | Zinc finger |
IPR007087 | 477 | 498 | PS00028 | Zinc finger | |
IPR007087 | 507 | 528 | PS00028 | Zinc finger | |
IPR007087 | 566 | 586 | PS00028 | Zinc finger | |
IPR007087 | 594 | 615 | PS00028 | Zinc finger |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCTACTACTAAGCCATGCAGG |
Primer_r | AGCTGGGGTTCCTGTCTTCTG |
PCR product length | 138 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |