KIAA0467

Product ID	ORK05605
Accession No	AB007936
Description	seizure threshold 2 homolog (mouse)
Clone name	ff08895
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (10217 bp) Predicted protein sequence (2687 aa)
Source	Human fetal brain
Rouge ID	mKIAA0467 by Kazusa Mouse cDNA Project
Note	We replaced hg01512, former representative clones for KIAA0467 with ff08895. (2005/08/06)

Length: 10217 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2153 bp
Genome contig ID	gi89161185f_43561384
PolyA signal sequence (None)	+--------+--------+----*----+---- CTAAATTCTCACCTTTAAAAATTGTCCTGACCTTT
Flanking genome sequence (129509 - 129558)	----+--------+--------+--------+--------+----* GCTTGCCCTTCTCAGGTATTCCATGCTGCTGTCTCTACTTCCTCTCCTCG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	43661384	43690891	57	100.0	Perfect prediction

Length: 2687 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX07098	98.5	hCG2036582, iso...	Homo sapiens
EAX07096	97.7	hCG2036582, iso...	Homo sapiens
EAX07097	97.6	hCG2036582, iso...	Homo sapiens
XP_613325	90.0	similar to hCG2...	Bos taurus
XP_001477707	89.2	hypothetical pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TTTCTCTGCTGCTTCCCTCCC
Primer_r	GGACATCACTGCTGGACATTC
PCR product length	204 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles