KIAA0473

Product ID	ORK00085
Accession No	AB007942
Description	DnaJ (Hsp40) homolog, subfamily C, member 6, transcript variant 2
Clone name	hh00220
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5747 bp) Predicted protein sequence (937 aa)
HaloTag ORF Clone	FHC00085
Flexi ORF Clone	FXC00085
Source	Human adult brain
Rouge ID	mKIAA0473 by Kazusa Mouse cDNA Project

Length: 5747 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2848 bp
Genome contig ID	gi89161185f_65403025
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- GCTAAAATAAATGTAGCATCTAATTTTATCAGTTT
Flanking genome sequence (251117 - 251166)	----+--------+--------+--------+--------+----* AACATCTGATATGTCTTCTATCCATGTACAATATTTTAAATGGATTTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	65503025	65654140	19	99.4	Perfect prediction

Length: 937 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75061	100.0	Putative tyrosi...	Homo sapiens
XP_001161700	99.6	DnaJ (Hsp40) ho...	Pan troglodytes
XP_001090170	99.6	similar to DnaJ...	Macaca mulatta
CAI18999	98.7	DnaJ (Hsp40) ho...	Homo sapiens
XP_001161657	98.3	DnaJ (Hsp40) ho...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028998	5.9e-07	25.7	KIAA1075

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001623	885	926	PF00226	Heat shock protein DnaJ
HMMSmart	IPR001623	872	933	SM00271	Heat shock protein DnaJ
ProfileScan	IPR014019	79	246	PS51181	Phosphatase tensin type
	IPR000387	163	234	PS50056	Protein-tyrosine phosphatase
	IPR014020	252	390	PS51182	C2 tensin-type
	IPR001623	873	937	PS50076	Heat shock protein DnaJ
ScanRegExp	IPR000387	186	198	PS00383	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	190	DGRAASSILVGAMFIFCNLYSTP	212	PRIMARY	23

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	TTGCTCATTCCCTACACAGAC
Primer_r	GATTGAACCTGGAAGTCTGGG
PCR product length	183 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles