KIAA0487

Product ID	ORK01669
Accession No	AB007956
Description	nudix (nucleoside diphosphate linked moiety X)-type motif 4, transcript variant 1
Clone name	fk08362
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3639 bp) Predicted protein sequence (234 aa)
HaloTag ORF Clone	FHC01669
Flexi ORF Clone	FXC01669
Source	Human fetal brain
Note	We replaced hg00960, former representative clones for KIAA0487 with fk08362. (2005/08/06)

Length: 3639 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2897 bp
Genome contig ID	gi89161190f_92195865
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATATTTGGAAACATCAAATAAAAATGGAAAAAATG
Flanking genome sequence (124319 - 124368)	----+--------+--------+--------+--------+----* ATCATGGCTTTAAAAAAAAAACAAAAACACACACACATGAACTCAGATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	92295865	92320182	6	99.1	Perfect prediction
Ensembl gnome browser	1	r	143847481	143851271	3	99.0	Internal No-hit

Length: 234 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001105592	1.3e-82	98.3	similar to nudi...	Macaca mulatta
XP_532650	7e-72	89.4	similar to nudi...	Canis lupus fam...
Q5RAF0	1.1e-61	100.0	Diphosphoinosit...	Pongo abelii
AAV38910	1.1e-61	100.0	nudix (nucleosi...	synthetic construct
BAE91688	1.3e-61	99.4	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000086	100	114	PR00502	NUDIX hydrolase
FPrintScan	IPR000086	114	129	PR00502	NUDIX hydrolase
HMMPfam	IPR000086	71	200	PF00293	NUDIX hydrolase
ScanRegExp	IPR000086	105	126	PS00893	NUDIX hydrolase

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-