KIAA0510

Product ID	ORK06941
Accession No	AB007979
Description	Rho guanine nucleotide exchange factor (GEF) 40
Clone name	hh00345
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5596 bp) Predicted protein sequence (95 aa)
Source	Human adult brain

Length: 5596 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5306 bp
Genome contig ID	gi89161185r_173450956
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CACATTTTCTATACGTTAATAAAAGATCCTGAAAG
Flanking genome sequence (205415 - 205366)	----+--------+--------+--------+--------+----* GCTTTTCAAAAGGGGAAAGGTAGGAAGATCAATGTGAGAAAAAATGTTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	173550468	173556370	2	98.9	Terminal No-hit

Length: 95 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAD66575	2.9e-20	90.3	unnamed protein...	Homo sapiens
EAW66413	3e-20	90.3	hypothetical pr...	Homo sapiens
BAB15753	5.2e-20	90.3	FLJ00056 protei...	Homo sapiens
EAW66412	5.7e-20	90.3	hypothetical pr...	Homo sapiens
EAW66411	5.8e-20	90.3	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TAACAAGCAGAGATTCCAGTC
Primer_r	TACTCCTCAGACGATGCACAC
PCR product length	132 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles