KIAA0513

Product ID	ORK00549
Accession No	AB011085
Description	KIAA0513, transcript variant 2
Clone name	hf00293
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7758 bp) Predicted protein sequence (412 aa)
HaloTag ORF Clone	FHC00549
Flexi ORF Clone	FXC00549
Source	Human adult brain
Rouge ID	mKIAA0513 by Kazusa Mouse cDNA Project

Length: 7758 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	5891 bp
Genome contig ID	gi51511732f_83554319
PolyA signal sequence (AATAAA,-14)	+--------+--------+----*----+---- TTGTCAGAAGGTAGAAACTGAAATAAACTAACTTT
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	83654319	83693065	15	98.8	Terminal No-hit

Length: 412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001113080	3.7e-166	98.1	hypothetical pr...	Macaca mulatta
EDL92696	6.5e-150	88.6	similar to RIKE...	Rattus norvegicus
BAC32067	1e-149	88.6	unnamed protein...	Mus musculus
BAC27873	1.2e-149	88.6	unnamed protein...	Mus musculus
BAC32707	1.8e-149	88.6	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

RT-PCR

Experimental conditions

Primer_f	ACCGAGCGGGACACAAGATTG
Primer_r	TCACATCCAGACATTACCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ACCGAGCGGGACACAAGATTG
Primer_r	TCACATCCAGACATTACCTTG
PCR product length	98 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles