KIAA0591

Product ID	ORK01098
Accession No	AB011163
Description	kinesin family member 1B
Clone name	hj02790y1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hj02790y1 has an irregular adapter sequence (GTCGACCCAC GCGTCCGTAA TACGACTCAC TATAGGGCGA ATTGGGTACC GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (7002 bp) Predicted protein sequence (1849 aa)
HaloTag ORF Clone	FHC01098
Flexi ORF Clone	FXC01098
Source	Human adult brain
Rouge ID	mKIAA0591 by Kazusa Mouse cDNA Project
Note	We replaced hj02790, former representative clones for KIAA0591 with hj02790y1. (2003/4/2)

Length: 7002 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1350 bp
Genome contig ID	gi89161185f_10094261
PolyA signal sequence (None)	+--------+--------+----*----+---- TCCAGCCTGGGTGACAGAGCAAGACTCTGCCTCAG
Flanking genome sequence (266323 - 266372)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAATAATAATGCTGGGTAGTGACCTTGTGATTGTTACAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	10194261	10360582	48	99.6	Perfect prediction

Length: 1849 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10360	100.0	kinesin family ...	synthetic construct
O60333	99.9	Kinesin-like pr...	Homo sapiens
CAI95754	99.9	kinesin family ...	Homo sapiens
Q60575	97.0	Kinesin-like pr...	Mus musculus
AAD39438	96.8	kif1b major iso...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040881	9.9e-104	92.4	KIAA1448
AB014606	1.7e-84	71.4	KIAA0706
AB014539	3.2e-57	40.6	KIAA0639
AB046810	7e-56	39.5	KIAA1590
D26361	6.7e-46	34.4	KIAA0042

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	121	142	PR00380	Kinesin
	IPR001752	241	258	PR00380	Kinesin
	IPR001752	276	294	PR00380	Kinesin
	IPR001752	337	358	PR00380	Kinesin
HMMPfam	IPR001752	44	388	PF00225	Kinesin
	IPR000253	589	660	PF00498	Forkhead-associated
	IPR001849	1735	1832	PF00169	Pleckstrin-like
HMMSmart	IPR001752	36	395	SM00129	Kinesin
	IPR000253	588	645	SM00240	Forkhead-associated
	IPR001849	1735	1834	SM00233	Pleckstrin-like
ProfileScan	IPR001752	35	306	PS50067	Kinesin
	IPR000253	589	645	PS50006	Forkhead-associated
	IPR001849	1734	1832	PS50003	Pleckstrin-like
ScanRegExp	IPR001752	275	286	PS00411	Kinesin

Primer_f	GAAGGGAAATGCCAAGGATGC
Primer_r	TCCAACTGTACCACCACCATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAAGGGAAATGCCAAGGATGC
Primer_r	TCCAACTGTACCACCACCATC
PCR product length	207 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles