KIAA0617

Product ID	ORK00577
Accession No	AB014517
Description	cullin 3, transcript variant 1
Clone name	hg03834
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6716 bp) Predicted protein sequence (786 aa)
HaloTag ORF Clone	FHC00577
Flexi ORF Clone	FXC00577
Source	Human adult brain
Rouge ID	mKIAA0617 by Kazusa Mouse cDNA Project

Length: 6716 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4093 bp
Genome contig ID	gi89161199r_224943113
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTGCAATGTGGGAAAATTAAAATTCTCAGTCTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTCTTTCTGCAGTTGTGATTCTTGAATAAATGCCTCAGCACGATGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	225043113	225158290	16	99.3	Perfect prediction

Length: 786 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q13618	100.0	Cullin-3; Short...	Homo sapiens
XP_614056	99.7	similar to Cull...	Bos taurus
XP_422620	99.6	similar to cull...	Gallus gallus
Q9JLV5	99.5	Cullin-3; Short...	Mus musculus
EAW70829	99.7	cullin 3, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014595	1.9e-52	38.2	KIAA0695

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001373	52	684	PF00888	Cullin
HMMSmart	IPR001373	431	581	SM00182	Cullin
ProfileScan	IPR001373	401	653	PS50069	Cullin
ScanRegExp	IPR001373	759	786	PS01256	Cullin

Primer_f	CCCCAAGATGCTGATGATAGG
Primer_r	AAACCTAAGATGATGCCAGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCCCAAGATGCTGATGATAGG
Primer_r	AAACCTAAGATGATGCCAGTG
PCR product length	167 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles