KIAA0641

Product ID	ORK04004
Accession No	AB014541
Description	apoptosis-associated tyrosine kinase, transcript variant 2
Clone name	hj03494s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5087 bp) Predicted protein sequence (1326 aa)
Flexi ORF Clone	FXC04004
Source	Human adult brain
Rouge ID	mKIAA0641 by Kazusa Mouse cDNA Project
Note	We replaced hj03494, former representative clones for KIAA0641 with hj03494s1. (2002/5/10)

Length: 5087 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1104 bp
Genome contig ID	gi51511734r_76605693
PolyA signal sequence (AAGAAA,-10)	+--------+--------+----*----+---- CTTGTTTTTTAAGAGAAATGAAGCTAAGAAAAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACCTTTGTGTGTTGTCTTCTGAGGTCTGCCGATGATAAAGTCCTGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	76705693	76720343	13	99.3	Perfect prediction

Length: 1326 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6ZMQ8	0	99.8	Serine/threonin...	Homo sapiens
XP_001111343	0	92.5	similar to apop...	Macaca mulatta
XP_001720798	0	99.9	similar to Seri...	Homo sapiens
EDM06810	1.1e-214	72.3	rCG32884, isofo...	Rattus norvegicus
XP_001075880	1.1e-214	72.3	similar to apop...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067470	4.4e-33	35.5	KIAA1883
AB029002	1.3e-25	34.2	KIAA1079

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	80	345	PD000001	Protein kinase
FPrintScan	IPR001245	154	167	PR00109	Tyrosine protein kinase
	IPR001245	195	213	PR00109	Tyrosine protein kinase
	IPR001245	270	292	PR00109	Tyrosine protein kinase
HMMPfam	IPR001245	77	347	PF07714	Tyrosine protein kinase
HMMSmart	IPR001245	77	347	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	77	350	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	77	347	PS50011	Protein kinase
ScanRegExp	IPR000719	83	108	PS00107	Protein kinase
ScanRegExp	IPR008266	201	213	PS00109	Tyrosine protein kinase

Primer_f	TGACTCAGCTAGACCCGTAAG
Primer_r	CCCTCCACCCCTGATCTTTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TGACTCAGCTAGACCCGTAAG
Primer_r	CCCTCCACCCCTGATCTTTTG
PCR product length	107 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles