Gene/Protein Characteristic Table for KIAA0671
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01672
Accession No AB014571
Description suppressor of cytokine signaling 5, transcript variant 1
Clone name hk02368
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4423 bp)
Predicted protein sequence (537 aa)
Flexi ORF Clone FXC01672
Source Human adult brain
Rouge ID mKIAA0671 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4423 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 537 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75159 0 100.0 Suppressor of c...
Homo sapiens
XP_001113221 0 99.6 suppressor of c...
Macaca mulatta
AAH32862 0 99.8 SOCS5 protein [...
Homo sapiens
Q29RN6 0 97.8 Suppressor of c...
Bos taurus
XP_531810 0 97.6 similar to Cyto...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000980 383 461 PD000093 SH2 motif
HMMPfam IPR000980 383 460 PF00017 SH2 motif
IPR001496 482 519 PF07525 SOCS protein
HMMSmart IPR000980 380 466 SM00252 SH2 motif
IPR001496 476 519 SM00253 SOCS protein
ProfileScan IPR000980 382 477 PS50001 SH2 motif
IPR001496 472 521 PS50225 SOCS protein
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f AGCAGGTTAAATGAAGTCTTG
Primer_r GTAGGTTTGGATGAAGTTCTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name GeneBridge 4
Primer_f AGCAGGTTAAATGAAGTCTTG
Primer_r GTAGGTTTGGATGAAGTTCTC
PCR product length 224 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp