Gene/Protein Characteristic Table for KIAA0714
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01113
Accession No AB018257
Description listerin E3 ubiquitin protein ligase 1
Clone name pf12310
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (7650 bp)
Predicted protein sequence (1780 aa)
Flexi ORF Clone FXC01113
Source Human brain (hippocampus)
Rouge ID mKIAA0714 by Kazusa Mouse cDNA Project
Note We replaced hj00574, former representative clones for KIAA0714 with pf12310. (2005/08/06)
Features of the cloned cDNA sequence
Description

Length: 7650 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 2307 bp
Genome contig ID gi51511750r_29122345
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTCTGATTTTTAAATAAATAAAATGTTACTCTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GTACTTCTCCCTGGCGCCATTCTCCTCCTTCTTTCCCTAGAGCTAACGTA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 21 r 29222345 29287039 30 99.6 Perfect prediction
Features of the protein sequence
Description

Length: 1780 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_514851 0 99.4 zinc finger pro...
Pan troglodytes
O94822 0 100.0 Zinc finger pro...
Homo sapiens
AAI40791 0 99.9 Zinc finger pro...
Homo sapiens
XP_001103642 0 97.8 similar to zinc...
Macaca mulatta
XP_001915227 0 91.8 similar to Zinc...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001841 1751 1775 PF00097 Zinc finger
HMMSmart IPR011016 1728 1776 SM00744 Zinc finger
ProfileScan IPR001841 1729 1776 PS50089 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AAGGTGCCTCCATTTATCAAG
Primer_r TAACTACCACTCCGCTTCATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 21
Experimental conditions
Panel name GeneBridge 4
Primer_f GCAAACTGAGCTATTCTTACC
Primer_r TTAAGAGTGGCAAAAGGCAGG
PCR product length 167 bp
PCR conditions 95 °C15 sec60 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp