KIAA0764

Product ID	ORK00629
Accession No	AB018307
Description	suppressor of Ty 7 (S. cerevisiae)-like, transcript variant 1
Clone name	hk04750
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4261 bp) Predicted protein sequence (419 aa)
HaloTag ORF Clone	FHC00629
Flexi ORF Clone	FXC00629
Source	Human adult brain

Length: 4261 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2673 bp
Genome contig ID	gi89161199r_27627183
PolyA signal sequence (ATTAAA,-30)	+--------+--------+----*----+---- TTAAAATTAAAAAGTCTTTATCCAAGTCACCAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACAGGATTCTGATTCATTAATCATGTCTTGCCCACTTTTTTCAACAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	27727183	27739953	6	99.2	Perfect prediction

Length: 419 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94864	6.4e-163	100.0	STAGA complex 6...	Homo sapiens
XP_001098585	1.5e-162	99.8	SPTF-associated...	Macaca mulatta
AAG47636	2.2e-161	99.5	antigen ART1/P1...	Homo sapiens
XP_001098896	5e-161	99.3	SPTF-associated...	Macaca mulatta
XP_001502177	5.8e-161	98.3	similar to STAG...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006565	156	235	PF07524	Bromodomain transcription factor
HMMSmart	IPR006565	156	235	SM00576	Bromodomain transcription factor

Primer_f	GTATGAAATGTGCCTCTGACC
Primer_r	TTCCCACGTGCACATACTGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-