Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06455 |
---|---|
Accession No | AB018314 |
Description | protein phosphatase 1, regulatory subunit 13B |
Clone name | hk05113 |
Vector information | |
cDNA sequence | DNA sequence (4250 bp) Predicted protein sequence (948 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0771
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 881 | 932 | PD000066 | Src homology-3 |
FPrintScan | IPR002110 | 779 | 791 | PR01415 | Ankyrin |
IPR002110 | 791 | 803 | PR01415 | Ankyrin | |
IPR001452 | 880 | 890 | PR00452 | Src homology-3 | |
IPR001452 | 894 | 909 | PR00452 | Src homology-3 | |
IPR001452 | 925 | 937 | PR00452 | Src homology-3 | |
HMMPfam | IPR002110 | 778 | 810 | PF00023 | Ankyrin |
IPR002110 | 811 | 843 | PF00023 | Ankyrin | |
IPR001452 | 880 | 937 | PF00018 | Src homology-3 | |
HMMSmart | IPR002110 | 778 | 807 | SM00248 | Ankyrin |
IPR002110 | 811 | 840 | SM00248 | Ankyrin | |
IPR001452 | 880 | 938 | SM00326 | Src homology-3 | |
ProfileScan | IPR002110 | 745 | 843 | PS50297 | Ankyrin |
IPR002110 | 778 | 810 | PS50088 | Ankyrin | |
IPR002110 | 811 | 843 | PS50088 | Ankyrin | |
IPR001452 | 877 | 939 | PS50002 | Src homology-3 |
RT-PCR-ELISA |
Primer_f | GCACTGTAGCCCATCACCTTG |
---|---|
Primer_r | TTACACAGCGTCAGCAGCGTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |