Gene/Protein Characteristic Table for KIAA0775
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00632
Accession No AB018318
Description TBK1 binding protein 1
Clone name hk05255
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4121 bp)
Predicted protein sequence (639 aa)
Flexi ORF Clone FXC00632
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4121 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 639 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
A7MCY6 7.5e-158 100.0 TANK-binding ki...
Homo sapiens
XP_001082242 2.1e-155 98.4 similar to ProS...
Macaca mulatta
XP_001253301 2e-151 95.6 similar to TBK1...
Bos taurus
Q6DG50 3.6e-145 93.3 TANK-binding ki...
Rattus norvegicus
A2A9T0 2.4e-144 93.0 TANK-binding ki...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CACCCACCTACATTTCCTCTG
Primer_r TTGGATAAGAGCGGGACATGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp