Order Kazusa clone(s) from : ![]() |
Product ID | ORK00640 |
---|---|
Accession No | AB018335 |
Description | transmembrane protein 63A |
Clone name | hk05691 |
Vector information | |
cDNA sequence | DNA sequence (4074 bp) Predicted protein sequence (828 aa) |
HaloTag ORF Clone |
FHC00640
![]() |
Flexi ORF Clone | FXC00640 |
Source | Human adult brain |
Rouge ID |
mKIAA0792
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1400 bp |
---|---|
Genome contig ID | gi89161185r_223999863 |
PolyA signal sequence (AGTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 224099863 | 224136671 | 25 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003864 | 356 | 790 | PF02714 | Protein of unknown function DUF221 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 67 | TFGGIPTVLLIDVSCFLFLILVF | 89 | PRIMARY | 23 | 2 | 166 | HIIFLLVVVSFLSLCVILPVNLS | 188 | PRIMARY | 23 | 3 | 212 | DLLWLHTIFAVIYLFFTVGFMRH | 234 | PRIMARY | 23 | 4 | 446 | INFTLFLGLFFLTTPSIILSTMD | 468 | SECONDARY | 23 | 5 | 487 | FFPTLLLWSFSALLPSIVYYSTL | 509 | PRIMARY | 23 | 6 | 528 | YIFLIFMVLILPSLGLTSLDFFF | 550 | PRIMARY | 23 | 7 | 583 | ASAFIGNGMELLRLPGLILYTFR | 605 | SECONDARY | 23 | 8 | 635 | MLCVFTVIVAYSITCPIIAPFGL | 657 | PRIMARY | 23 | 9 | 689 | VNQALAAPILCLFWLYFFSFLRL | 711 | PRIMARY | 23 | 10 | 717 | ATLFTFLVLLLTILVCLAHTCFG | 739 | PRIMARY | 23 |
---|
![]() |
Primer_f | CAGCCTCTCTCACCTCTTCAG |
---|---|
Primer_r | ATGCTGTCCTTTGGCTCCGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGCCTCTCTCACCTCTTCAG |
Primer_r | ATGCTGTCCTTTGGCTCCGAG |
PCR product length | 144 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |