KIAA0841

Product ID	ORK00652
Accession No	AB020648
Description	HAUS augmin-like complex, subunit 5
Clone name	hk04975
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4283 bp) Predicted protein sequence (641 aa)
HaloTag ORF Clone	FHC00652
Flexi ORF Clone	FXC00652
Source	Human adult brain
Rouge ID	mKIAA0841 by Kazusa Mouse cDNA Project

Length: 4283 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2357 bp
Genome contig ID	gi42406306f_40695513
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AAATATCAGAATAAAGTCATGATTTTTCTCTTTCT
Flanking genome sequence (112580 - 112629)	----+--------+--------+--------+--------+----* AAAAAATATGTATTTCCCTAGTTAAGTCCCCTGAAAAGGTCTAAATATAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	40795513	40808091	19	99.4	Perfect prediction

Length: 641 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDM07727	5.6e-170	73.5	rCG53815 [Rattu...	Rattus norvegicus
AAI18935	6.1e-164	72.9	RIKEN cDNA 2310...	Mus musculus
AAH89002	6.2e-164	72.9	2310022K01Rik p...	Mus musculus
XP_355883	6.2e-164	72.9	hypothetical pr...	Mus musculus
XP_001001304	6.2e-164	72.9	similar to 2310...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TTCACCCCAACACCTCACCTC
Primer_r	GGTTTTAGGGGGTGCTTTAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 19

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TTCACCCCAACACCTCACCTC
Primer_r	GGTTTTAGGGGGTGCTTTAGC
PCR product length	166 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles