Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK02001 |
---|---|
Accession No | AB020679 |
Description | MON1 secretory trafficking family member B, transcript variant 1 |
Clone name | hk07213 |
Vector information | |
cDNA sequence | DNA sequence (4118 bp) Predicted protein sequence (552 aa) |
HaloTag ORF Clone |
FHC02001
|
Flexi ORF Clone | FXC02001 |
Source | Human adult brain |
Rouge ID |
mKIAA0872
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR004353 | 115 | 132 | PR01546 | Protein of unknown function DUF254 |
IPR004353 | 133 | 153 | PR01546 | Protein of unknown function DUF254 | |
IPR004353 | 167 | 181 | PR01546 | Protein of unknown function DUF254 | |
IPR004353 | 190 | 218 | PR01546 | Protein of unknown function DUF254 | |
IPR004353 | 219 | 231 | PR01546 | Protein of unknown function DUF254 | |
IPR004353 | 249 | 270 | PR01546 | Protein of unknown function DUF254 | |
IPR004353 | 273 | 286 | PR01546 | Protein of unknown function DUF254 | |
IPR004353 | 301 | 317 | PR01546 | Protein of unknown function DUF254 | |
IPR004353 | 325 | 348 | PR01546 | Protein of unknown function DUF254 | |
IPR004353 | 354 | 380 | PR01546 | Protein of unknown function DUF254 | |
IPR004353 | 483 | 497 | PR01546 | Protein of unknown function DUF254 | |
IPR004353 | 499 | 512 | PR01546 | Protein of unknown function DUF254 | |
IPR004353 | 512 | 532 | PR01546 | Protein of unknown function DUF254 | |
HMMPfam | IPR004353 | 104 | 532 | PF03164 | Protein of unknown function DUF254 |
RT-PCR-ELISA |
Primer_f | GCAGCCACCCCTTATTAACAG |
---|---|
Primer_r | CTGGAGAAAAGAGGCTGTGGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |