Gene/Protein Characteristic Table for KIAA0889
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07672
Accession No AB020696
Description suppressor of glucose, autophagy associated 1
Clone name hk08008
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4122 bp)
Predicted protein sequence (535 aa)
Source Human adult brain
Rouge ID mKIAA0889 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4122 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 535 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB13954 1.9e-208 100.0 unnamed protein...
Homo sapiens
EAW76098 1.7e-187 99.8 chromosome 20 o...
Homo sapiens
O94964 9.7e-181 99.8 Uncharacterized...
Homo sapiens
EAW76099 9.9e-181 99.8 chromosome 20 o...
Homo sapiens
XP_514623 1.1e-180 99.8 hypothetical pr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB018345 1.2e-17 35.5 KIAA0802
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGCTCGACTGTTCCCCTTACC
Primer_r CTCCTTGGTGTCTTTCTCTGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 20
Experimental conditions
Panel name GeneBridge 4
Primer_f TGCTCGACTGTTCCCCTTACC
Primer_r CTCCTTGGTGTCTTTCTCTGG
PCR product length 119 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp