Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06211 |
---|---|
Accession No | AB020713 |
Description | nucleoporin 210kDa |
Clone name | hk10347 |
Vector information | |
cDNA sequence | DNA sequence (4217 bp) Predicted protein sequence (923 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0906
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1444 bp |
---|---|
Genome contig ID | gi89161205r_13232737 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 13332737 | 13359747 | 20 | 99.5 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003343 | 113 | 188 | PF02368 | Bacterial Ig-like |
HMMSmart | IPR003343 | 113 | 188 | SM00635 | Bacterial Ig-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | FPAPAKAVVYVSDIQELYIRVVD | 23 | SECONDARY | 23 | 2 | 517 | ELSGAMVVGDVLCLATVLTSLEG | 539 | PRIMARY | 23 | 3 | 558 | TGVAVARAVGSVTVYYEVAGHLR | 580 | SECONDARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GAAAATGTCCTTGAGATGGCA |
---|---|
Primer_r | TGATAAGCTGCCATGAAAGTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |