Gene/Protein Characteristic Table for KIAA0913
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07736
Accession No AB020720
Description zinc finger, SWIM-type containing 8
Clone name fh07519s2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5919 bp)
Predicted protein sequence (1881 aa)
Flexi ORF Clone FXC07736
Source Human fetal brain
Rouge ID mKIAA0913 by Kazusa Mouse cDNA Project
Note We replaced hk04127, former representative clones for KIAA0913 with fh07519s2. (2008/12/19)
Features of the cloned cDNA sequence
Description

Length: 5919 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 273 bp
Genome contig ID gi89161187f_75115388
PolyA signal sequence
(TATAAA,-21)
+----*----+----*----+----*----+----
GGCATTTATAAATATATAAACTCCTTTTTTACTCT
Flanking genome sequence
(116170 - 116219)
----+----*----+----*----+----*----+----*----+----*
AGTCGACCTGGGCCTTTCCCTTCTTTCCAAATTCCATGTGCAGATGAACC
Features of the protein sequence
Description

Length: 1881 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_536393 0 97.8 similar to CG32...
Canis lupus fam...
AAH85161 0 96.0 2310021P13Rik p...
Mus musculus
XP_507850 0 97.8 hypothetical pr...
Pan troglodytes
XP_001099765 0 97.3 similar to CG32...
Macaca mulatta
XP_862999 0 95.3 similar to CG32...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB040944 1.2e-11 30.8 KIAA1511
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007527 257 293 PF04434 Zinc finger
ProfileScan IPR000694 15 85 PS50099 Proline-rich region
NULL 631 687 PS50315 NULL
NULL 1195 1256 PS50324 NULL
IPR000694 1545 1702 PS50099 Proline-rich region
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp