KIAA0920

Product ID	ORK00682
Accession No	AB023137
Description	PALM2-AKAP2 readthrough, transcript variant 1
Clone name	hh02592
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5210 bp) Predicted protein sequence (1134 aa)
HaloTag ORF Clone	FHC00682
Flexi ORF Clone	FXC00682
Source	Human adult brain
Rouge ID	mKIAA0920 by Kazusa Mouse cDNA Project

Length: 5210 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1706 bp
Genome contig ID	gi89161216f_111482398
PolyA signal sequence (None)	+--------+--------+----*----+---- AATTTCTGGATGAGAAAATTTTCAATTCTGGCCAG
Flanking genome sequence (489907 - 489956)	----+--------+--------+--------+--------+----* TGAGAAAGAAAAAAAAATAAACAGCCTTCTTTTTTTTTCCTTTGTTTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	111582398	111972303	11	99.6	Perfect prediction

Length: 1134 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAC38839	100.0	AKAP-2 protein ...	Homo sapiens
XP_001106950	97.0	A kinase (PRKA)...	Macaca mulatta
AAI40819	98.8	PALM2-AKAP2 [Ho...	Homo sapiens
EAW59054	98.8	hCG28765, isofo...	Homo sapiens
EAW59055	82.6	hCG28765, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CGTTTCTCTCCATATTTGCCC
Primer_r	AAGCAGACACGATCCTAAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 9

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CGTTTCTCTCCATATTTGCCC
Primer_r	AAGCAGACACGATCCTAAAGC
PCR product length	225 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles